NAME
Bio::PrimarySeq - Bioperl lightweight Sequence Object
SYNOPSIS
# The Bio::SeqIO for file reading, Bio::DB::GenBank for
# database reading
use Bio::Seq;
use Bio::SeqIO;
use Bio::DB::GenBank;
#make from memory
$seqobj = Bio::PrimarySeq->new ( -seq => 'ATGGGGTGGGCGGTGGGTGGTTTG',
-id => 'GeneFragment-12',
-accession => 'X78121',
-moltype => 'dna'
);
# read from file
$inputstream = Bio::SeqIO->new(-file => "myseq.fa",-format => 'Fasta');
$seqobj = $inputstream->next_seq();
# get from database
$db = Bio::DB::GenBank->new();
$seqobj = $db->get_Seq_by_acc('X78121');
# to get out parts of the sequence.
print "Sequence ", $seqobj->id(), " with accession ", $seqobj->accession, " and desc ", $seqobj->desc, "\n";
$string = $seqobj->seq();
$string2 = $seqobj->subseq(1,40);
DESCRIPTION
PrimaySeq is a lightweight Sequence object, storing little more than the sequence, its name, a computer useful unique name. It does not contain sequence features or other information. To have a sequence with sequence features you should use the Seq object which uses this object.
Sequence objects are defined by the Bio::PrimarySeqI interface, and this object is a pure Perl implementation of the interface (if that's gibberish to you, don't worry. The take home message is that this object is the bioperl default sequence object, but other people can use their own objects as sequences if they so wish). If you are interested in wrapping your own objects as compliant Bioperl sequence objects, then you should read the Bio::PrimarySeqI documentation
The documenation of this object is a merge of the Bio::PrimarySeq and Bio::PrimarySeqI documentation. This allows all the methods which you can call on sequence objects here.
Reimplementation
The Sequence object was completely rewritten for the 0.6 series. This was because the old Sequence object was becoming heavily bloated and difficult to maintain. There are some key changes from the old object to the new object, but basically, everything should work with the new object with a minimal number of changes.
The key change is that the format IO has been removed from this object and moved to the Bio::SeqIO system, which provides a much better way to encapsulate the sequence format reading. Please read the SeqIO documentation, but the take home message is that lines like
# old style reading from files
$seq = Bio::Seq->new( -file => "myfile");
Becomes
# new style reading from files.
$inputstream = Bio::SeqIO->new( -file => "myfile", -format => 'Fasta');
$seqobj = $inputstream->next_seq();
For writing files, a similar system is used
# old style writing to files
print OUTPUT $seq->layout_fasta;
# new style writing to files
$outputstream = Bio::SeqIO->new( -fh => \*OUTPUT, -format => 'Fasta');
$outputstream->write_seq($seqobj);
Deprecated methods
A number of methods which were present in the old 0.04/0.05 series have been deprecated. Most of these methods work as before, but provide a warning that someone has called a deprecated method.
- getseq - use seq/subseq instead
- str - use seq/subseq instead
- ary - use seq/subseq with your own split afterwards
- type - use moltype, but notice that moltype returns different values (lowercase)
FEEDBACK
Mailing Lists
User feedback is an integral part of the evolution of this and other Bioperl modules. Send your comments and suggestions preferably to one of the Bioperl mailing lists. Your participation is much appreciated.
vsns-bcd-perl@lists.uni-bielefeld.de - General discussion
vsns-bcd-perl-guts@lists.uni-bielefeld.de - Technically-oriented discussion
http://bio.perl.org/MailList.html - About the mailing lists
Reporting Bugs
report bugs to the Bioperl bug tracking system to help us keep track the bugs and their resolution. Bug reports can be submitted via email or the web:
bioperl-bugs@bio.perl.org
http://bio.perl.org/bioperl-bugs/
AUTHOR - Ewan Birney
Email birney@sanger.ac.uk
Describe contact details here
APPENDIX
The rest of the documentation details each of the object methods. Internal methods are usually preceded with a _
seq
Title : seq
Usage : $string = $obj->seq()
Function: Returns the sequence as a string of letters. The
case of the letters is left up to the implementer.
Suggested cases are upper case for proteins and lower case for
DNA sequence (IUPAC standard), but you should not rely on this
Returns : A scalar
subseq
Title : subseq
Usage : $substring = $obj->subseq(10,40);
Function: returns the subseq from start to end, where the first base
is 1 and the number is inclusive, ie 1-2 are the first two
bases of the sequence
Returns : a string
Args :
display_id
Title : display_id
Usage : $id_string = $obj->display_id();
Function: returns the display id, aka the common name of the Sequence object.
The semantics of this is that it is the most likely string to be
used as an identifier of the sequence, and likely to have "human" readability.
The id is equivalent to the ID field of the GenBank/EMBL databanks and
the id field of the Swissprot/sptrembl database. In fasta format, the >(\S+)
is presumed to be the id, though some people overload the id to embed other
information. Bioperl does not use any embedded information in the ID field,
and people are encouraged to use other mechanisms (accession field for example,
or extending the sequence object) to solve this.
Returns : A string
Args : None
accession_number
Title : accession_number
Usage : $unique_key = $obj->accession_number;
Function: Returns the unique biological id for a sequence, commonly
called the accession_number. For sequences from established
databases, the implementors should try to use the correct
accession number. Notice that primary_id() provides the
unique id for the implemetation, allowing multiple objects
to have the same accession number in a particular implementation.
For sequences with no accession number, this method should return
"unknown".
Returns : A string
Args : A string (optional) for setting
primary_id
Title : primary_id
Usage : $unique_key = $obj->primary_id;
Function: Returns the unique id for this object in this
implementation. This allows implementations to manage
their own object ids in a way the implementaiton can control
clients can expect one id to map to one object.
For sequences with no natural primary id, this method should return
a stringified memory location.
Returns : A string
Args : A string (optional, for setting)
moltype
Title : moltype
Usage : if( $obj->moltype eq 'dna' ) { /Do Something/ }
Function: Returns the type of sequence being one of
'dna', 'rna' or 'protein'. This is case sensitive.
This is not called <type> because this would cause
upgrade problems from the 0.5 and earlier Seq objects.
Returns : a string either 'dna','rna','protein'. NB - the object must
make a call of the type - if there is no type specified it
has to guess.
Args : none
desc
Title : desc
Usage : $obj->desc($newval)
Function:
Example :
Returns : value of desc
Args : newvalue (optional)
can_call_new
Title : can_call_new
Usage :
Function:
Example :
Returns :
Args :
Methods Inherieted from Bio::PrimarySeqI
These methods are available on Bio::PrimarySeq, although they are actually implemented on Bio::PrimarySeqI
revcom
Title : revcom
Usage : $rev = $seq->revcom()
Function: Produces a new Bio::SeqI implementing object which
is the reversed complement of the sequence. For protein
sequences this throws an exception of
"Sequence is a protein. Cannot revcom"
The id is the same id as the orginal sequence, and the
accession number is also indentical. If someone wants to
track that this sequence has be reversed, it needs to
define its own extensions
To do an inplace edit of an object you can go:
$seqobj = $seqobj->revcom();
This of course, causes Perl to handle the garbage
collection of the old object, but it is roughly speaking as
efficient as an inplace edit.
Returns : A new (fresh) Bio::SeqI object
Args : none
trunc
Title : trunc
Usage : $subseq = $myseq->trunc(10,100);
Function: Provides a truncation of a sequence,
Example :
Returns : a fresh Bio::SeqI implementing object
Args :
Internal methods
These are internal methods to PrimarySeq
_guess_type
Title : _guess_type
Usage :
Function:
Example :
Returns :
Args :