/ 
Bio-Tools-CodonOptTable
River stage zero No dependents
/ Bio::Tools::CodonOptTable

NAME

Bio::Tools::CodonOptTable - A more elaborative way to check the codons quality

VERSION

Version 0.01

SYNOPSIS

We produces each codon frequency, Relative Synonymous Codons Uses and Relative Adaptiveness of a Codon

that will help you to calculate the Codon Adaptation Index (CAI) of a gene, to see the gene expression level.

Perhaps a little code snippet.

    use Bio::Tools::CodonOptTable;

    my $seqobj = Bio::Tools::CodonOptTable->new ( -seq => 'ATGGGGTGGGCACCATGCTGCTGTCGTGAATTTGGGCACGATGGTGTACGTGCTCGTAGCTAGGGTGGGTGGTTTG',
				   -id  => 'GeneFragment-12',
				   -accession_number => 'Myseq1',
				   -alphabet => 'dna',
				   -is_circular => 1
				   );

    #If you wanna read from file
    my $seqobj = Bio::Tools::CodonOptTable->new(-file => "contig.fasta",
                                             -format => 'Fasta');
    
    #If you have Accession number and want to get file from NCBI
    my $seqobj = Bio::Tools::CodonOptTable->new(-ncbi_id => "J00522");
    
    my $myCodons = $seqobj->rscu_rac_table();
    
    if($myCodons)
	{
	    for my $a (@$myCodons)
		    {
		       print "Codon 	: ",$a->{'codon'},"\t";
		       print "Frequency : ",$a->{'frequency'},"\t";
		       print "AminoAcid : ",$a->{'aa_name'},"\t";
		       print "RSCU	: ",$a->{'rscu'},"\t"; #Relative Synonymous Codons Uses
		       print "RAC	: ",$a->{'rac'},"\t"; #Relative Adaptiveness of a Codon
		       print "\n";
		    }
	}
    ...

METHODS Title : new Usage1 : $seq = Bio::Tools::CodonOptTable->new( -seq => 'ATGGGGGTGGTGGTACCCT', -id => 'human_id', -accession_number => 'AL000012', );

    Usage2   : $seq    = Bio::Tools::CodonOptTable->new( -file => 'myseq.fasta',
					      -format => 'fasta',
					      );
					      
    Usage3   : $seq    = Bio::Tools::CodonOptTable->new( -ncbi_id => 'J00522');
					      
    Function: Returns a new primary seq object from
	      basic constructors, being a string for the sequence
	      and strings for id and accession_number.
	    
    Returns : a new Bio::PrimarySeq object
    
    Args    : -seq         	=> sequence string
	      -display_id  	=> display id of the sequence (locus name) 
	      -accession_number => accession number
	      -primary_id  	=> primary id (Genbank id)
	      -desc        	=> description text
	      -alphabet    	=> molecule type (dna,rna,protein)
	      -id          	=> alias for display id
	      -file		=> file location
	      -format		=> file format
	      -ncbi_id		=> NCBI accession number
	      
    Note    : IF you are reading sequence from file it will call _read_localfile method
	      IF you are fetching file form NCBI it will call _read_remotefile method

METHODS Title : calculate_rscu

    Function: Calculate the RSCU(Relative Synonymous Codons Uses).
	    	      
    Note    : The formula is used in the following references.
	    http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pubmed&pubmedid=3547335

METHODS Title : calculate_rac

    Function: Calculate the RAC(Relative Adaptiveness of a Codon).
	    	      
    Note    : The formula is used in the following references.
	    http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pubmed&pubmedid=3547335

AUTHOR

Rakesh Kumar Shardiwal, <rakesh.shardiwal at gmail.com>

BUGS

Please report any bugs or feature requests to bug-bio-tools-codonopttable at rt.cpan.org, or through the web interface at http://rt.cpan.org/NoAuth/ReportBug.html?Queue=Bio-Tools-CodonOptTable. I will be notified, and then you'll automatically be notified of progress on your bug as I make changes.

SUPPORT

You can find documentation for this module with the perldoc command.

perldoc Bio::Tools::CodonOptTable

You can also look for information at:

ACKNOWLEDGEMENTS

COPYRIGHT & LICENSE

Copyright 2008 Rakesh Kumar Shardiwal, all rights reserved.

This program is free software; you can redistribute it and/or modify it under the same terms as Perl itself.