NAME

Bio::Grep::Benchmarks - Bio::Grep Benchmarks

DESCRIPTION

A collection of quick and dirty benchmarks.

BENCHMARKS

Intel(R) Xeon(TM) CPU 2.40GHz, 1GB RAM. Fedora Core 6.

TAIR7_cdna_20070425 (Arabidopsis CDNA Fasta file, 52MB).

Bio::Grep v0.9.2. Average over 10 iterations.

Database Generation

  GUUGle         :  11.12 sec
  Agrep/RE       :  22.52 sec
  Vmatch (-pl 3) : 171.56 sec

  

Mismatches

Query: ugacagaagagagugagcac (revcom)

No mismatches (exact matching):

  Agrep (Wu-Manber):  0.33 sec
  Vmatch           :  1.63 sec
  RE               :  1.88 sec
  GUUGle           :  9.97 sec
  Agrep (TRE)      : 15.96 sec

Note that Vmatch needs one slow run to load the suffix arrays in memory (Values are the average over 10 iterations). Also note that GUUGle allows GU mismatches.

One mismatch:

  Vmatch           :  0.20 sec
  Agrep (Wu-Manber):  1.30 sec
  Agrep (TRE)      : 47.01 sec
  GUUGle           :       n/a
  RE               :       n/a

Two mismatches:

  Vmatch           :  0.20 sec
  Agrep (Wu-Manber):  1.55 sec
  Agrep (TRE)      : 59.17 sec
  GUUGle           :       n/a
  RE               :       n/a

Three mismatches:

  Vmatch           :  0.48 sec
  Agrep (Wu-Manber):  1.55 sec
  Agrep (TRE)      : 72.56 sec
  GUUGle           :       n/a
  RE               :       n/a

Four mismatches:

  Vmatch           :  1.55 sec
  Agrep (Wu-Manber):  2.17 sec
  Agrep (TRE)      : 83.50 sec
  GUUGle           :       n/a
  RE               :       n/a

Five mismatches:

  Agrep (Wu-Manber):  2.94 sec
  Vmatch           :  6.43 sec
  Agrep (TRE)      : 96.16 sec
  GUUGle           :       n/a
  RE               :       n/a

FEEDBACK

The script that generated these benchmarks is available in the script directory of this distribution.

Please report any bugs, feature requests and benchmarks to bug-bio-grep@rt.cpan.org, or through the web interface at http://rt.cpan.org.

AUTHOR

Markus Riester, <mriester@gmx.de>

LICENCE AND COPYRIGHT

Copyright (C) 2007 by M. Riester. All rights reserved.

This module is free software; you can redistribute it and/or modify it under the same terms as Perl itself.