NAME

Bio::PrimarySeq - Bioperl lightweight Sequence Object

SYNOPSIS

# Bio::SeqIO for file reading, Bio::DB::GenBank for
# database reading

use Bio::Seq;
use Bio::SeqIO;
use Bio::DB::GenBank;

# make from memory

$seqobj = Bio::PrimarySeq->new ( -seq => 'ATGGGGTGGGCGGTGGGTGGTTTG',
                                 -id  => 'GeneFragment-12',
                                 -accession_number => 'X78121',
                                 -alphabet => 'dna',
                                 -is_circular => 1 );
print "Sequence ", $seqobj->id(), " with accession ",
  $seqobj->accession_number, "\n";

# read from file

$inputstream = Bio::SeqIO->new(-file => "myseq.fa",
                               -format => 'Fasta');
$seqobj = $inputstream->next_seq();
print "Sequence ", $seqobj->id(), " and desc ", $seqobj->desc, "\n";

# to get out parts of the sequence.

print "Sequence ", $seqobj->id(), " with accession ",
  $seqobj->accession_number, " and desc ", $seqobj->desc, "\n";

$string  = $seqobj->seq();
$string2 = $seqobj->subseq(1,40);

DESCRIPTION

PrimarySeq is a lightweight Sequence object, storing the sequence, its name, a computer-useful unique name, and other fundamental attributes. It does not contain sequence features or other information. To have a sequence with sequence features you should use the Seq object which uses this object.

Although new users will use Bio::PrimarySeq a lot, in general you will be using it from the Bio::Seq object. For more information on Bio::Seq see Bio::Seq. For interest you might like to know that Bio::Seq has-a Bio::PrimarySeq and forwards most of the function calls to do with sequence to it (the has-a relationship lets us get out of a otherwise nasty cyclical reference in Perl which would leak memory).

Sequence objects are defined by the Bio::PrimarySeqI interface, and this object is a pure Perl implementation of the interface. If that's gibberish to you, don't worry. The take home message is that this object is the bioperl default sequence object, but other people can use their own objects as sequences if they so wish. If you are interested in wrapping your own objects as compliant Bioperl sequence objects, then you should read the Bio::PrimarySeqI documentation

The documentation of this object is a merge of the Bio::PrimarySeq and Bio::PrimarySeqI documentation. This allows all the methods which you can call on sequence objects here.

FEEDBACK

Mailing Lists

User feedback is an integral part of the evolution of this and other Bioperl modules. Send your comments and suggestions preferably to one of the Bioperl mailing lists. Your participation is much appreciated.

bioperl-l@bioperl.org                  - General discussion
http://bioperl.org/wiki/Mailing_lists  - About the mailing lists

Support

Please direct usage questions or support issues to the mailing list:

bioperl-l@bioperl.org

rather than to the module maintainer directly. Many experienced and reponsive experts will be able look at the problem and quickly address it. Please include a thorough description of the problem with code and data examples if at all possible.

Reporting Bugs

Report bugs to the Bioperl bug tracking system to help us keep track the bugs and their resolution. Bug reports can be submitted via the web:

https://redmine.open-bio.org/projects/bioperl/

AUTHOR - Ewan Birney

Email birney@ebi.ac.uk

APPENDIX

The rest of the documentation details each of the object methods. Internal methods are usually preceded with a _

new

Title   : new
Usage   : $seq    = Bio::PrimarySeq->new( -seq => 'ATGGGGGTGGTGGTACCCT',
                                          -id  => 'human_id',
                                          -accession_number => 'AL000012',
                                          );

Function: Returns a new primary seq object from
          basic constructors, being a string for the sequence
          and strings for id and accession_number.

          Note that you can provide an empty sequence string. However, in
          this case you MUST specify the type of sequence you wish to
          initialize by the parameter -alphabet. See alphabet() for possible
          values.
Returns : a new Bio::PrimarySeq object
Args    : -seq         => sequence string
          -display_id  => display id of the sequence (locus name)
          -accession_number => accession number
          -primary_id  => primary id (Genbank id)
          -version     => version number
          -namespace   => the namespace for the accession
          -authority   => the authority for the namespace
          -description => description text
          -desc        => alias for description
          -alphabet    => sequence type (alphabet) (dna|rna|protein)
          -id          => alias for display id
          -is_circular => boolean field for whether or not sequence is circular
          -direct      => boolean field for directly setting sequence (requires alphabet also set)
          -ref_to_seq  => boolean field indicating the sequence is a reference (?!?)
          -nowarnonempty => boolean field for whether or not to warn when sequence is empty

seq

Title   : seq
Usage   : $string    = $obj->seq()
Function: Returns the sequence as a string of letters. The
          case of the letters is left up to the implementer.
          Suggested cases are upper case for proteins and lower case for
          DNA sequence (IUPAC standard), but you should not rely on this.
Returns : A scalar
Args    : Optionally on set the new value (a string). An optional second
          argument presets the alphabet (otherwise it will be guessed).

validate_seq

Title   : validate_seq
Usage   : if(! $seq->validate_seq($seq_str) ) {
               print "sequence $seq_str is not valid for an object of
               alphabet ",$seq->alphabet, "\n";
          }
Function: Validates a given sequence string. A validating sequence string
          must be accepted by seq(). A string that does not validate will
          lead to an exception if passed to seq().

          The implementation provided here does not take alphabet() into
          account. Allowed are all letters (A-Z) and '-','.','*','?','=',
          and '~'.

Example :
Returns : 1 if the supplied sequence string is valid for the object, and
          0 otherwise.
Args    : The sequence string to be validated.

subseq

Title   : subseq
Usage   : $substring = $obj->subseq(10,40);
          $substring = $obj->subseq(10,40,NOGAP)
          $substring = $obj->subseq(-START=>10,-END=>40,-REPLACE_WITH=>'tga')
Function: returns the subseq from start to end, where the first sequence
          character has coordinate 1 number is inclusive, ie 1-2 are the 
          first two characters of the sequence
Returns : a string
Args    : integer for start position
          integer for end position
                OR
          Bio::LocationI location for subseq (strand honored)
          Specify -NOGAP=>1 to return subseq with gap characters removed
          Specify -REPLACE_WITH=>$new_subseq to replace the subseq returned
          with $new_subseq in the sequence object

length

Title   : length
Usage   : $len = $seq->length();
Function: Get the length of the sequence in number of symbols (bases
          or amino acids).

          You can also set this attribute, even to a number that does
          not match the length of the sequence string. This is useful
          if you don''t want to set the sequence too, or if you want
          to free up memory by unsetting the sequence. In the latter
          case you could do e.g.

              $seq->length($seq->length);
              $seq->seq(undef);

          Note that if you set the sequence to a value other than
          undef at any time, the length attribute will be
          invalidated, and the length of the sequence string will be
          reported again. Also, we won''t let you lie about the length.

Example :
Returns : integer representing the length of the sequence.
Args    : Optionally, the value on set

display_id

Title   : display_id or display_name
Usage   : $id_string = $obj->display_id();
Function: returns the display id, aka the common name of the Sequence object.

          The semantics of this is that it is the most likely string to
          be used as an identifier of the sequence, and likely to have
          "human" readability.  The id is equivalent to the ID field of
          the GenBank/EMBL databanks and the id field of the
          Swissprot/sptrembl database. In fasta format, the >(\S+) is
          presumed to be the id, though some people overload the id to
          embed other information. Bioperl does not use any embedded
          information in the ID field, and people are encouraged to use
          other mechanisms (accession field for example, or extending
          the sequence object) to solve this.

          With the new Bio::DescribeableI interface, display_name aliases
          to this method.

Returns : A string
Args    : None

accession_number

Title   : accession_number or object_id
Usage   : $unique_key = $obj->accession_number;
Function: Returns the unique biological id for a sequence, commonly
          called the accession_number. For sequences from established
          databases, the implementors should try to use the correct
          accession number. Notice that primary_id() provides the
          unique id for the implemetation, allowing multiple objects
          to have the same accession number in a particular implementation.

          For sequences with no accession number, this method should
          return "unknown".

          [Note this method name is likely to change in 1.3]

          With the new Bio::IdentifiableI interface, this is aliased
          to object_id

Returns : A string
Args    : A string (optional) for setting

primary_id

Title   : primary_id
Usage   : $unique_key = $obj->primary_id;
Function: Returns the unique id for this object in this
          implementation. This allows implementations to manage their
          own object ids in a way the implementaiton can control
          clients can expect one id to map to one object.

          For sequences with no natural primary id, this method
          should return a stringified memory location.

Returns : A string
Args    : A string (optional, for setting)

alphabet

Title   : alphabet
Usage   : if( $obj->alphabet eq 'dna' ) { /Do Something/ }
Function: Get/Set the alphabet of sequence, one of
          'dna', 'rna' or 'protein'. This is case sensitive.

          This is not called <type> because this would cause
          upgrade problems from the 0.5 and earlier Seq objects.

Returns : a string either 'dna','rna','protein'. NB - the object must
          make a call of the type - if there is no alphabet specified it
          has to guess.
Args    : optional string to set : 'dna' | 'rna' | 'protein'

desc

Title   : desc or description
Usage   : $obj->desc($newval)
Function: Get/set description of the sequence.

          'description' is an alias for this for compliance with the
          Bio::DescribeableI interface.

Example :
Returns : value of desc (a string)
Args    : newvalue (a string or undef, optional)

can_call_new

Title   : can_call_new
Usage   :
Function:
Example :
Returns : true
Args    :

id

Title   : id
Usage   : $id = $seq->id()
Function: This is mapped on display_id
Example :
Returns :
Args    :

is_circular

Title   : is_circular
Usage   : if( $obj->is_circular) { /Do Something/ }
Function: Returns true if the molecule is circular
Returns : Boolean value
Args    : none

Methods for Bio::IdentifiableI compliance

object_id

Title   : object_id
Usage   : $string    = $obj->object_id()
Function: A string which represents the stable primary identifier
          in this namespace of this object. For DNA sequences this
          is its accession_number, similarly for protein sequences.

          This is aliased to accession_number().
Returns : A scalar

version

Title   : version
Usage   : $version    = $obj->version()
Function: A number which differentiates between versions of
          the same object. Higher numbers are considered to be
          later and more relevant, but a single object described
          the same identifier should represent the same concept.

Returns : A number

authority

Title   : authority
Usage   : $authority    = $obj->authority()
Function: A string which represents the organisation which
          granted the namespace, written as the DNS name for
          organisation (eg, wormbase.org).

Returns : A scalar

namespace

Title   : namespace
Usage   : $string    = $obj->namespace()
Function: A string representing the name space this identifier
          is valid in, often the database name or the name
          describing the collection.

Returns : A scalar

Methods for Bio::DescribableI compliance

This comprises of display_name and description.

display_name

Title   : display_name
Usage   : $string    = $obj->display_name()
Function: A string which is what should be displayed to the user.
          The string should have no spaces (ideally, though a cautious
          user of this interface would not assumme this) and should be
          less than thirty characters (though again, double checking
          this is a good idea).

          This is aliased to display_id().
Returns : A scalar

description

Title   : description
Usage   : $string    = $obj->description()
Function: A text string suitable for displaying to the user a
          description. This string is likely to have spaces, but
          should not have any newlines or formatting - just plain
          text. The string should not be greater than 255 characters
          and clients can feel justified at truncating strings at 255
          characters for the purposes of display.

          This is aliased to desc().
Returns : A scalar

Methods Inherited from Bio::PrimarySeqI

These methods are available on Bio::PrimarySeq, although they are actually implemented on Bio::PrimarySeqI

revcom

Title   : revcom
Usage   : $rev = $seq->revcom()
Function: Produces a new Bio::SeqI implementing object which
          is the reversed complement of the sequence. For protein
          sequences this throws an exception of
          "Sequence is a protein. Cannot revcom".

          The id is the same id as the orginal sequence, and the
          accession number is also indentical. If someone wants to
          track that this sequence has be reversed, it needs to
          define its own extensions.

          To do an inplace edit of an object you can go:

          $seqobj = $seqobj->revcom();

          This of course, causes Perl to handle the garbage
          collection of the old object, but it is roughly speaking as
          efficient as an inplace edit.

Returns : A new (fresh) Bio::SeqI object
Args    : none

trunc

Title   : trunc
Usage   : $subseq = $myseq->trunc(10,100);
Function: Provides a truncation of a sequence,

Example :
Returns : A fresh Bio::SeqI implementing object.
Args    :

Internal methods

These are internal methods to PrimarySeq

_guess_alphabet

Title   : _guess_alphabet
Usage   :
Function: Automatically guess and set the type of sequence: dna, rna or protein
Example :
Returns : one of strings 'dna', 'rna' or 'protein'.
Args    : none

cpanm Bio::Seq

perl -MCPAN -e shell
install Bio::Seq