/ 
BioPerl-1.007001
River stage two • 60 direct dependents • 65 total dependents
/ Bio::Map::Microsatellite

NAME

Bio::Map::Microsatellite - An object representing a Microsatellite marker.

SYNOPSIS

$o_usat = Bio::Map::Microsatellite->new
    (-name=>'Chad Super Marker 2',
     -sequence => 'gctgactgatcatatatatatatatatatatatatatatatcgcgatcgtga',
     -motif => 'at',
     -repeats => 15,
     -repeat_start_position => 11
     );

$sequence_before_usat = $o_usat->get_leading_flank();
$sequence_after_usat = $o_usat->get_trailing_flank();

DESCRIPTION

This object handles the notion of an Microsatellite. This microsatellite can be placed on a (linear) Map or used on its own. If this Microsatellites will be used in a mapping context (it doesn't have to, you know) it can have multiple positions in a map. For information about a Microsatellite's position in a map one must query the associate PositionI object which is accessible through the position() method.

FEEDBACK

Mailing Lists

User feedback is an integral part of the evolution of this and other Bioperl modules. Send your comments and suggestions preferably to the Bioperl mailing list. Your participation is much appreciated.

bioperl-l@bioperl.org                  - General discussion
http://bioperl.org/wiki/Mailing_lists  - About the mailing lists

Support

Please direct usage questions or support issues to the mailing list:

bioperl-l@bioperl.org

rather than to the module maintainer directly. Many experienced and reponsive experts will be able look at the problem and quickly address it. Please include a thorough description of the problem with code and data examples if at all possible.

Reporting Bugs

Report bugs to the Bioperl bug tracking system to help us keep track of the bugs and their resolution. Bug reports can be submitted via the web:

https://github.com/bioperl/bioperl-live/issues

AUTHOR - Chad Matsalla

Email bioinformatics1@dieselwurks.com

CONTRIBUTORS

Heikki Lehvaslaiho heikki-at-bioperl-dot-org Lincoln Stein lstein@cshl.org Jason Stajich jason@bioperl.org Sendu Bala bix@sendu.me.uk

APPENDIX

The rest of the documentation details each of the object methods. Internal methods are usually preceded with a _

new

 Title   : new
 Usage   : $o_usat = 
 Function: Builds a new Bio::Map::Microsatellite object
 Returns : Bio::Map::Microsatellite
 Args    :
	-name    => name of this microsatellite (optional, string,
		default 'Unknown microsatellite')
        -positions => position(s) for this marker in maps[optional],
                An array reference of tuples (array refs themselves)
                Each tuple conatins a Bio::Map::MapI-inherited object and a 
		Bio::Map::PositionI-inherited obj, no default)
	-sequence => the sequence of this microsatellite (optional,
		 scalar, no default)
	-motif => the repeat motif of this microsatellite (optional,
		 scalar, no default)
	-repeats => the number of motif repeats for this microsatellite
		(optional, scalar, no default)
	-repeat_start_position => the starting position of the
		microsatellite in this sequence. The first base of the
		sequence is position "1". (optional, scalar, no default)

 Note    : Creating a Bio::Map::Microsatellite object with no position
	might be useful for microsatellite people wanting to embrace
	and extend this module. <raising hand> Me! Me! Me!
	- using repeat_start_position will trigger a mechinism to
	calculate a value for repeat_end_position.

motif

 Title   : motif
 Usage   : $o_usat->motif($new_motif);
	       my $motif = $o_usat->motif();
 Function: Get/Set the repeat motif for this Microsatellite.
 Returns : A scalar representing the current repeat motif of this
	       Microsatellite.
 Args    : none to get, OR string to set

sequence

 Title   : sequence
 Usage   : $o_usat->sequence($new_sequence);
	       my $sequence = $o_usat->sequence();
 Function: Get/Set the sequence for this Microsatellite.
 Returns : A scalar representing the current sequence of this
	       Microsatellite.
 Args    : none to get, OR string to set

repeats

 Title   : repeats
 Usage   : $o_usat->repeats($new_repeats);
	       my $repeats = $o_usat->repeats()
 Function: Get/Set the repeat repeats for this Microsatellite.
 Returns : A scalar representing the current number of repeats of this
	       Microsatellite.
 Args    : none to get, OR int to set

repeat_start_position

 Title   : repeat_start_position
 Usage   : $o_usat->repeat_start_position($new_repeat_start_position);
	       my $repeat_start_position = $o_usat->repeat_start_position();
 Function: Get/Set the repeat repeat_start_position for this
	       Microsatellite
 Returns : A scalar representing the repeat start position for this 
	       Microsatellite.
 Args    : none to get, OR string to set
	       This method will also try to set the repeat end position. This
	       depends on having information for the motif and the number of
	       repeats. If you want to use methods like get_trailing_flank or
	       get_leading flank, be careful to include the right information.

repeat_end_position

 Title   : repeat_end_position
 Usage   : $o_usat->repeat_end_position("set");
	       $o_usat->repeat_end_position($value);
	       $current_repeat_end_position = $o_usat->repeat_end_position();
 Function: Get/set the end position of the repeat in this sequence.
 Returns : A scalar representing the base index of the end of the
	       repeat in this Microsatellite. The first base in the sequence
	       is base 1.
 Args    : A scalar representing a value, the string "set", or no
	       argument (see Notes).
 Notes   : If you do not provide an argument to this method, the current
           end position of the repeat in this Microsatellite will be
           returned (a scalar).
           If you provide the string "set" to this method it will set the
           end position based on the start position, the length of the
           motif, and the number of repeats.
           If you specify a value the current end position of the repeat
           will be set to that value. This is a really bad idea. Don't do
           it.

equals

Title   : equals
Usage   : if ($mappable->equals($mapable2)) {...}
Function: Test if a position is equal to another position
Returns : boolean
Args    : Bio::Map::MappableI

less_than

Title   : less_than
Usage   : if ($mappable->less_than($m2)) {...}
Function: Tests if a position is less than another position
Returns : boolean
Args    : Bio::Map::MappableI

greater_than

Title   : greater_than
Usage   : if ($mappable->greater_than($m2)) {...}
Function: Tests if position is greater than another position
Returns : boolean
Args    : Bio::Map::MappableI

get_leading_flank

 Title   : get_leading_flank
 Usage   : $leading_sequence = $o_usat->get_leading_flank();
 Returns : A scalar representing the sequence before the repeats in this
	       Microsatellite.
 Args    : none

get_trailing_flank

 Title   : get_trailing_flank
 Usage   : $trailing_flank = $o_usat->get_trailing_flank();
 Returns : A scalar representing the sequence after the repeats in this
	       Microsatellite.
 Args    : none